Kelvi

Biology questions for 2023

Click on a question to view the full question and options.

How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?

Large, colourful, fragrant flowers with nectar are seen in:

The phenomenon of pleiotropism refers to

Frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

Given below are two statements: $\newline$ Statement I: The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. $\newline$ Statement II: Transpiration cools leaf surfaces sometimes 10 to 3 degrees, by evaporative cooling. $\newline$ Choose the most appropriate answer from the options given below:

Which micronutrient is required for splitting of water molecule during photosynthesis?

The reaction centre in PS II has an absorption maxima at:

$\newline$ Identify the correct statements: $\newline$ (A) Detrivores perform fragmentation. $\newline$ (B) The humus is further degraded by some microbes during mineralization. $\newline$ (C) Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. $\newline$ (D) The detritus food chain begins with living organisms. $\newline$ (E) Earthworms break down detritus into smaller particles by a process called catabolism.

The thickness of ozone in a column of air in the atmosphere is measured in terms of:

10.

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:

11.

Given below are two statements: $\newline$ Assertion A: ATP is used at two steps in glycolysis. $\newline$ Reason R: First ATP is used in converting glucose into glucose-6 phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1,6-diphosphate. $\newline$ Choose the correct answer from the options given below:

12.

In the equation GPP – R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ____________.

13.

Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?

14.

Spraying of which of the following phytohormones on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

15.

Unequivocal proof that DNA is the genetic material was first proposed by:

16.

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

17.

Among eukaryotes, replication of DNA takes place in–

18.

Which of the following stages of meiosis involves division of centromere?

19.

The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year:

20.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: $\newline$ Assertion A: The first stage of gametophyte in the life cycle of moss is the protonema stage. $\newline$ Reason R: Protonema develops directly from spores produced in capsule. $\newline$ Choose the most appropriate answer from the options given below:

21.

In gene gun method used to introduce alien DNA into host cells, microparticles of _______ metal are used.

22.

Cellulose does not form blue colour with Iodine because:

23.

What is the function of tassels in the corn cob?

24.

Axile placentation is observed in:

25.

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:

26.

Expressed Sequence Tags (ESTs) refers to:

27.

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

28.

The process of appearance of recombination nodules occurs at which sub-stage of prophase I in meiosis?

29.

Which hormone promotes internode/petiole elongation in deep water rice?

30.

Upon exposure to UV radiation, DNA stained with ethidium bromide will show:

31.

Given below are two statements: $\newline$ Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. $\newline$ Statement II: Exarch condition is the most common feature of the root system. $\newline$ Choose the correct answer from the options given below:

32.

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by:

33.

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out:

34.

Identify the pair of heterosporous pteridophytes among the following:

35.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: $\newline$ Assertion A: Late wood has fewer xylary elements with narrow vessels. $\newline$ Reason R: Cambium is less active in winters. $\newline$ Choose the correct answer from the options given below:

36.

How many different proteins does the ribosome consist of?

37.

Match List I with List II:

38.

Match List I with List II:

39.

Given below are two statements: $\newline$ Statement I: Gause's Competitive Exclusion Principle states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. $\newline$ Statement II: In general, carnivores are more adversely affected by competition than herbivores. $\newline$ Choose the correct answer from the options given below:

40.

Match List I with List II: List I A. M phase B. G2 Phase C. Quiescent stage D. G1 Phase List II I. Proteins are synthesized II. Inactive phase III. Interval between mitosis and initiation of DNA replication IV. Equational division Choose the correct answer from the options given below:

41.

Which one of the following statements is NOT correct?

42.

Given below are two statements: $\newline$ Statement A: In gymnosperms, the pollen grains are released from the microsporangium and carried by air currents. $\newline$ Statement R: Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. $\newline$ Choose the correct answer from the options given below:

43.

Which of the following combinations is required for chemiosmosis?

44.

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence: $\newline$ A. Insertion of recombinant DNA into the host cell. $\newline$ B. Cutting of DNA at specific location by restriction enzyme. $\newline$ C. Isolation of desired DNA fragment. $\newline$ D. Amplification of gene of interest using PCR. $\newline$ Choose the correct answer from the options given below:

45.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: $\newline$ Assertion A: A flower is defined as a modified shoot wherein the shoot apical meristem changes to floral meristem. $\newline$ Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. $\newline$ Choose the correct answer from the options given below:

46.

Match List I with List II:

47.

Identify the correct statements: $\newline$ A. Lenticels are the lens-shaped openings permitting the exchange of gases. $\newline$ B. Bark formed early in the season is called hard bark. $\newline$ C. Bark is a technical term that refers to all tissues exterior to vascular cambium. $\newline$ D. Bark refers to periderm and secondary phloem. $\newline$ E. Phellogen is single-layered in thickness. $\newline$

48.

Which of the following statements are correct about Klinefelter's Syndrome? $\newline$ A. This disorder was first described by Langdon Down (1866). $\newline$ B. Such an individual has overall masculine development. However, the feminine development is also expressed. $\newline$ C. The affected individual is short statured. $\newline$ D. Physical, psychomotor and mental development is retarded $\newline$ E. Such individuals are sterile. $\newline$

49.

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of:

50.

Match List I with List II:

51.

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

52.

$\newline$ Which of the following statements are correct regarding the female reproductive cycle? $\newline$ A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. $\newline$ B. First menstrual cycle begins at puberty and is called menopause. $\newline$ C. Lack of menstruation may be indicative of pregnancy. $\newline$ D. Cyclic menstruation extends between menarche and menopause. $\newline$

53.

Match List I with List II

54.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: $\newline$ Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. $\newline$ Reason R: Ban on amniocentesis checks increasing menace of female foeticide. $\newline$ Choose the correct answer from the options given below:

55.

Which of the following are NOT considered as part of the endomembrane system? $\newline$ A. Mitochondria $\newline$ B. Endoplasmic Recticulum $\newline$ C. Chloroplasts $\newline$ D. Golgi complex $\newline$ E. Peroxisomes $\newline$ Choose the correct answer from the options given below:

56.

Vital capacity of lung is:

57.

Match List I with List II:

58.

Match List I with List II:

59.

Match List I with List II

60.

Given below are two statements: $\newline$ Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. $\newline$ Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibition. $\newline$ Choose the correct answer from the options given below:

61.

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation

62.

Match List I with List II:

63.

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

64.

Match List I with List II with respect to human eye:

65.

Which of the following functions is carried out by the cytoskeleton in a cell?

66.

Broad palm with a single palm crease is visible in a person suffering from:

67.

Given below are two statements: $\newline$ Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. $\newline$ Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. $\newline$ Choose the correct answer from the options given below:

68.

Match List I with List II:

69.

Given below are two statements: $\newline$ Statement I: Ligaments are dense irregular tissue. $\newline$ Statement II: Cartilage is dense regular tissue. $\newline$ Choose the correct answer from the options given below:

70.

In which blood corpuscles does HIV undergo replication and produce progeny viruses?

71.

Given below are two statements: $\newline$ Statement I: Electrostatic precipitator is most widely used in thermal power plants. $\newline$ Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. $\newline$ Choose the correct answer from the options given below:

72.

Given below are two statements: $\newline$ Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. $\newline$ Statement II: The cavity of the cervix is called cervical canal which along with vagina forms the birth canal. $\newline$ Choose the correct answer from the options given below:

73.

Match List I with List II

74.

Match List I with List II:

75.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: $\newline$ Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. $\newline$ Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. $\newline$ Choose the correct answer from the options given below:

76.

Given below are two statements: $\newline$ Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). $\newline$ Statement II: Adult human haemoglobin consists of 4 subunits (two subunits of α type and two subunits of β type). $\newline$ Choose the correct answer from the options given below:

77.

Which of the following statements is correct?

78.

Radial symmetry is NOT found in adults of phylum ___________

79.

Given below are two statements: $\newline$ Statement I: RNA mutates at a faster rate. $\newline$ Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. $\newline$ Choose the correct answer from the options given below:

80.

Which one of the following symbols represents mating between relatives in human pedigree analysis?

81.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: $\newline$ Assertion A: Endometrium is necessary for implantation of blastocyst. $\newline$ Reason R: In the absence of fertilization, the corpus luteum degenerates causing disintegration of endometrium. $\newline$ Choose the correct answer from the options given below:

82.

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by:

83.

Match List I with List II:

84.

Which of the following is not a cloning vector?

85.

Match List I with List II:

86.

Which of the following are NOT under the control of thyroid hormone? $\newline$ A. Maintenance of water and electrolyte balance $\newline$ B. Regulation of basal metabolic rate $\newline$ C. Normal rhythm of sleep-wake cycle $\newline$ D. Development of immune system $\newline$ E. Support the process of RBC formation $\newline$ Choose the correct answer from the options given below:

87.

Which of the following statements are correct? $\newline$ A. An excessive loss of body fluid from the body switches off osmoreceptors. $\newline$ B. ADH facilitates water reabsorption to prevent diuresis. $\newline$ C. ANF causes vasodilation. $\newline$ D. ADH causes an increase in blood pressure. $\newline$ E. ADH is responsible for a decrease in GFR. $\newline$ Choose the correct answer from the options given below:

88.

In cockroach, excretion is brought about by: $\newline$ A. Phallic gland $\newline$ B. Urecose gland $\newline$ C. Nephrocytes $\newline$ D. Fat body $\newline$ E. Collaterial glands $\newline$ Choose the correct answer from the options given below:

89.

The parts of the human brain that help in the regulation of sexual behaviour, expression of excitement, pleasure, rage, fear, etc. are:

90.

Which of the following statements are correct? $\newline$ A. Basophils are the most abundant cells of the total WBCs. $\newline$ B. Basophils secrete histamine, serotonin, and heparin. $\newline$ C. Basophils are involved in inflammatory response. $\newline$ D. Basophils have a kidney-shaped nucleus. $\newline$ E. Basophils are agranulocytes. $\newline$ Choose the correct answer from the options given below:

91.

Which one of the following is the sequence on the corresponding coding strand, if the sequence on mRNA formed is as follows: 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

92.

Which of the following statements are correct regarding skeletal muscle? $\newline$ A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. $\newline$ B. Sarcoplasmic reticulum of muscle fibre is a storehouse of calcium ions. $\newline$ C. Striated appearance of skeletal muscle fibre is due to the distribution pattern of actin and myosin proteins. $\newline$ D. M line is considered as the functional unit of contraction called sarcomere. $\newline$ Choose the most appropriate answer from the options given below:

93.

The unique mammalian characteristics are:

94.

Match List I with List II:

95.

Select the correct statements with reference to chordates: $\newline$ A. Presence of a mid-dorsal, solid and double nerve cord. $\newline$ B. Presence of a closed circulatory system. $\newline$ C. Presence of paired pharyngeal gill slits. $\newline$ D. Presence of a dorsal heart. $\newline$ E. Triploblastic pseudocoelomate animals. $\newline$ Choose the correct answer from the options given below:

96.

Which of the following is NOT an advantage of inbreeding?

97.

Given below are two statements: $\newline$ Statement I: During $G_0$ phase of the cell cycle, the cell is metabolically inactive. $\newline$ Statement II: The centrosome undergoes duplication during the S phase of interphase. $\newline$ Choose the correct answer from the options given below:

98.

Match List I with List II:

99.

Select the correct statements: $\newline$ A. Tetrad formation is seen during Leptotene. $\newline$ B. During Anaphase, the centromeres split and chromatids separate. $\newline$ C. Terminalization takes place during Pachytene. $\newline$ D. Nucleolus, Golgi complex and ER are reformed during Telophase. $\newline$ E. Crossing over takes place between sister chromatids of homologous chromosomes. $\newline$

100.

Which of the following is a characteristic feature of cockroach regarding sexual dimorphism?