To solve this problem, we need to determine the sequence on the coding strand of DNA that corresponds to the given mRNA sequence.$\newline$The mRNA sequence provided is:$\newline 5'$AUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCG$3'\newline$Let's break down the steps to find the corresponding coding strand:$\newline \bullet$The coding strand of DNA has the same sequence as the mRNA, except that thymine (T) replaces uracil (U).$\newline \bullet$Therefore, the sequence on the coding strand will be:$\newline 5'$ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG$3'\newline$Now, let's compare this sequence with the given options:$\newline \bullet$Option 1: 5'UAGCUAGCUAGCUAGCUAGCUAGCUAGC UAGC 3' - This is not the correct sequence as it contains uracil (U).$\newline \bullet$Option 2: 3'UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' - This is not the correct sequence as it is in the reverse direction and contains uracil (U).$\newline \bullet$Option 3: 5'ATCGATCGATCGATCGATCGATCGATCG 3' - This matches the sequence we derived for the coding strand.$\newline \bullet$Option 4: 3'ATCGATCGATCGATCGATCGATCGATCG 5' - This is in the reverse direction.$\newline$Therefore, the correct option is Option 3.